JustSayHi.com

Ann Arbor love, Ann Arbor romance at JustSayHi.com

JustSayHi.com Online Ann Arbor Dating is a 100% free dating service where you can search a whole catalog of Ann Arbor singles, complete with personality profiles and photos. Browse our Ann Arbor Dating personals, talk in our special Ann Arbor chat rooms and remain safe and anonymous the entire time. If you’re the kind of person who prefers to take action when you want something, create a free Ann Arbor dating profile and connect with thousands of Ann Arbor singles.



Ann Arbor Men | Ann Arbor Women
Ann Arbor Singles
searchlightsoul photo
searchlightsoul : Male : Age 35 : Ann Arbor, Michigan
dashingly handsome utterly irresistible worth waiting for I will let my DNA code describe the rest: ATCGTGTCGATCGATGCTAGCTGGCCCAACGATTTTCAAACTATGGAGTGATGCGTAGTC ...
Straypup photo
Straypup : Male : Age 38 : Ann Arbor, Michigan
I love adventure and passion.I like archery,YMCA,exciting women,and going out every now and then.I'm really more into the person then anything else.I grew up in Miami,Fl and have seen enough of the plastic crowd.I love...
CknappA2 photo
CknappA2 : Male : Age 21 : Ann Arbor, Michigan
Love to be outside as much as possible. Love to laugh and make people laugh. Enjoy being around my 2 Golden Retrievers.
xeiah photo
xeiah : Female : Age 32 : Ann Arbor, Michigan
I would really like to meet someone who loves to laugh and has a sence of adventure. I like men who work well with their hands and are creative as well as educated. Self educated is great too. I am passionate about...
focused76 photo
focused76 : Male : Age 24 : Ann Arbor, Michigan
I am a 24 year old recent graduate in the area for the time being. I just graduated from undergrad and going into grad school to major in finance. I love to laugh, try new things, travel and catch movies (both new and...
seabear photo
seabear : Female : Age 26 : Ann Arbor, Michigan
Art worshipper from NYC, but I'm not so Manhattan i can't enjoy downtime with a good book. On a search for the hidden treasures ann arbor has to offer. Readings, Art Shows, Parties, happenings, chill sessions, dinner...
Juslookin33 photo
Juslookin33 : Male : Age 22 : Ann Arbor, Michigan
Whats good people, i'm not gon make dis long or at least i'ma try, I'm gon be real doe i got a girl we stay together but i need a lil somethin on the side and i need a good looking female thats gon be cool wit that....
gweedoh565 photo
gweedoh565 : Male : Age 26 : Ann Arbor, Michigan
I'm a shy/quiet guy who spends too little time out meeting people. I'm currently a grad student in natural resources. Um, I'm in a folky band and I make my own music as well, although I try not to take myself too...
gjpzete photo
gjpzete : Male : Age 37 : Ann Arbor, Michigan
I hate blurbs, how can you encapsulate yourself in a blurb? I know I cant. I am a father of two young boys (5 & 3), they are just the greatest. I have had my heart broken, but that is in the past, but I do miss the...
froboy photo
froboy : Male : Age 20 : Ann Arbor, Michigan
I am a funny, cute, romantic, hippie and I am currently attending Alma College for a degree in Environmental Science. I love people, and good company. I enjoy spending time outdoors, in the woods or just wherever...



Online Dating in Ann Arbor for Free!

JustSayHi.com Ann Arbor Dating service is different from other matchmaking sites because we believe that you shouldn't ever have to pay to meet people. We also believe you deserve a high quality service. Whether you are looking for Ann Arbor singles only or anyone from any part of the world, you will be able to find it on JustSayHi.com. You'll find cute single Ann Arbor men and cute single Ann Arbor women that are looking for all kinds of interactions and relationships. Our members are interested in platonic and not-so-plantonic friendships, casual dating, serious relationships and maybe even true love.

As part of our high quality service, JustSayHi helps people find like minded people as well. There are all kinds of Ann Arbor singles and sometimes you may want to find another Ann Arbor man or Ann Arbor woman with similar religion or faith. For example, we have Ann Arbor Jewish singles, Ann Arbor Protestant singles, Ann Arbor Catholic singles, or even Ann Arbor Musclim singles. JustSayHi's Ann Arbor Online Dating site has them all. We also believe there is nothing wrong with different sexual orientations. So you'll also find Ann Arbor profiles of men and women who are gay, lesbian, bisexual or "curious". Of course, we have traditional Ann Arbor personals as well. Not only does JustSayHi provide Ann Arbor dating but also international dating. We have members in many countries eager that you can meet in our forums, chat rooms, instant messaging or by private messaging tools.

In short, we have every kind of person you could ask for - sexy Asians, passionate Latinas and Latinos, Black, Indian, lesbians, bisexual women and men, gay men, etc etc.

We have 1,000s of Ann Arbor Personals as well as personals from around the world ranging from various ages, interests and personalities. There are 18+ Ann Arbor teens, middle aged Ann Arbor professionals, Ann Arbor seniors, and young adults. You will be able to read all about them and interact with them in various ways on our site for free. Never pay a cent, no credit card is ever needed. There is nothing to lose and everything to gain so why wait? Join JustSayHi and meet somebody today!